View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_high_7 (Length: 273)
Name: NF0879_high_7
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0879_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 26 - 202
Target Start/End: Complemental strand, 54266178 - 54266002
Alignment:
| Q |
26 |
tcatgctttcttttttacaagtatatactatatattgctactaattgtaagtatattacataaatgagtaaaacaatcatttttgtttttaaaatgtgag |
125 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54266178 |
tcatgctttcttttttacaagtatataatatatattgctactaatagtaagtatattacataaatgagtaaaacaatcatttttgtttttaaaatgtgag |
54266079 |
T |
|
| Q |
126 |
gtatagatgtgtttattgttaattttacatataacttgtgtcagtgtagtgtgttctgctctacatgctttggatta |
202 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54266078 |
gtatatatgtgtttattgttaattttacatataacttgcgtcagtgtagtgtgttctgctctacatgctttggatta |
54266002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 52 times since January 2019
Visitors: 6713