View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_high_9 (Length: 265)
Name: NF0879_high_9
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0879_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 48 - 244
Target Start/End: Original strand, 3947281 - 3947476
Alignment:
| Q |
48 |
gttatcaggctcaacagggtcaatagttacagcttctgaaggcttgttttcaggttcagcctcagttgcagtttctgtgggattgttttcaggttctacc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3947281 |
gttatcaggctcaacagggtcaatagttacagcttctgaaggcttgttttcaggttcagcctcagttgcagtttctgtgggattgttttcaggttctacc |
3947380 |
T |
|
| Q |
148 |
cagaattcagttttctttccagttttggaaacagtgtcaaaaaacatcttgtggctttacatttcctttcacagtcactttttgttccttcatatca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3947381 |
cagaattcagttttctttccagttttggaaacagtgtc-aaaaacatcttgtggctttacatttcctttcacagtcactttttgttccttcatatca |
3947476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 244
Target Start/End: Original strand, 18602683 - 18602737
Alignment:
| Q |
190 |
aacatcttgtggctttacatttcctttcacagtcactttttgttccttcatatca |
244 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
18602683 |
aacatcttgtgggtttacatttcctttaacagtcaccttttgttcctccatatca |
18602737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 147 times since January 2019
Visitors: 6713