View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_low_12 (Length: 272)
Name: NF0879_low_12
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0879_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 34857267 - 34857018
Alignment:
| Q |
1 |
ctctgttgtgcccttcaaaaggagaagggggtggaatatatgcaatagtaatcactaacagttctataatatgaatatcccttgactattaaagttggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34857267 |
ctctgttgtgcccttcaaaaggagaagggggtggaatatatgcaatagtaatccctaacagttctataatatgaatatcccttgactattaaagtttgta |
34857168 |
T |
 |
| Q |
101 |
actgttatgcagcctacctatgatctctgcctagcgcgataattgtcattattaatgtcattattttttatacagaaggactctgcagcctaataaaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857167 |
actgttatgcagcctacctatgatctctgcctagcgtgataattgtcat------------tattttttatacagaaggactctgcagcctaataaaatt |
34857080 |
T |
 |
| Q |
201 |
agttatagcaagagagtgttgtgctggtggccattcacaggttagattctcttccttctgtg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857079 |
agttatagcaagagagtgttgtgctggtggccattcacaggttagattctcttccttctgtg |
34857018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University