View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_low_13 (Length: 268)
Name: NF0879_low_13
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0879_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 37 - 243
Target Start/End: Complemental strand, 616078 - 615872
Alignment:
| Q |
37 |
ctcttgtccttccctataaagtttttattgtaaagtataaatttattaattaataggcaaacaatttgaaagcttgagtaaccataggcttcacttaatt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
616078 |
ctcttgtccttccctataaagtttttattgtaaagtataaatttattaattaataggcaaacaatttgaaagcttgagtaaccataggcttcacttaatt |
615979 |
T |
 |
| Q |
137 |
aagggaccatgacgtatacttggttaaaagattctccattaattaaaacaaagctaaagaacatgcatttataaatggattctgatgcaaatatcattgt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
615978 |
aagggaccatgacgtatacttggttaaaagattctccattaattaaaacaaagctaaagaacatgcatttataaatggattctgatgcaaatatcattgt |
615879 |
T |
 |
| Q |
237 |
tcatctc |
243 |
Q |
| |
|
|| |||| |
|
|
| T |
615878 |
tcctctc |
615872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 47379548 - 47379619
Alignment:
| Q |
163 |
aaagattctccattaattaaaacaaagctaaagaacatgcatttataaatggattctgatgcaaatatcatt |
234 |
Q |
| |
|
||||||||||||||| |||| || ||||||||| ||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
47379548 |
aaagattctccattacaaaaaataaggctaaagaaaatgcatttacatatggacgctgatgcaaatatcatt |
47379619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University