View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_low_14 (Length: 265)
Name: NF0879_low_14
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0879_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 48 - 244
Target Start/End: Original strand, 3947281 - 3947476
Alignment:
Q |
48 |
gttatcaggctcaacagggtcaatagttacagcttctgaaggcttgttttcaggttcagcctcagttgcagtttctgtgggattgttttcaggttctacc |
147 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3947281 |
gttatcaggctcaacagggtcaatagttacagcttctgaaggcttgttttcaggttcagcctcagttgcagtttctgtgggattgttttcaggttctacc |
3947380 |
T |
 |
Q |
148 |
cagaattcagttttctttccagttttggaaacagtgtcaaaaaacatcttgtggctttacatttcctttcacagtcactttttgttccttcatatca |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3947381 |
cagaattcagttttctttccagttttggaaacagtgtc-aaaaacatcttgtggctttacatttcctttcacagtcactttttgttccttcatatca |
3947476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 244
Target Start/End: Original strand, 18602683 - 18602737
Alignment:
Q |
190 |
aacatcttgtggctttacatttcctttcacagtcactttttgttccttcatatca |
244 |
Q |
|
|
|||||||||||| |||||||||||||| |||||||| |||||||||| ||||||| |
|
|
T |
18602683 |
aacatcttgtgggtttacatttcctttaacagtcaccttttgttcctccatatca |
18602737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University