View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_low_6 (Length: 320)
Name: NF0879_low_6
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0879_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 63 - 223
Target Start/End: Complemental strand, 9571691 - 9571531
Alignment:
| Q |
63 |
attattctcaaatctcagcatatattttttatgctttggatatatgttatggatctctcattatattatgcacaataatctgtcttatacaattcaaccc |
162 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9571691 |
attactctcaaatctcagcatatattttttatgctttggatatatgttatggatctctcattatattatgcacaataatctgtcttatacaattcaaccc |
9571592 |
T |
 |
| Q |
163 |
cctccctaaaaaatataccaagagtcaaactttttagaaacagcttgtgtacgttaaaatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9571591 |
cctccctaaaaaatataccaagagtcaaactttttagaaacagcttgtgtacgttaaaatt |
9571531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University