View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_low_7 (Length: 317)
Name: NF0879_low_7
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0879_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 48 - 240
Target Start/End: Original strand, 3947281 - 3947472
Alignment:
| Q |
48 |
gttatcaggctcaacagggtcaatagttacagcttctgaaggcttgttttcaggttcagcctcagttgcagtttctgtgggattgttttcaggttctacc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3947281 |
gttatcaggctcaacagggtcaatagttacagcttctgaaggcttgttttcaggttcagcctcagttgcagtttctgtgggattgttttcaggttctacc |
3947380 |
T |
|
| Q |
148 |
cagaattcagttttctttccagttttggaaacagtgtcaaaaaacatcttgtggctttacatttcctttcacagtcactttttgttccttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3947381 |
cagaattcagttttctttccagttttggaaacagtgtc-aaaaacatcttgtggctttacatttcctttcacagtcactttttgttccttcat |
3947472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 236
Target Start/End: Original strand, 18602683 - 18602729
Alignment:
| Q |
190 |
aacatcttgtggctttacatttcctttcacagtcactttttgttcct |
236 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
18602683 |
aacatcttgtgggtttacatttcctttaacagtcaccttttgttcct |
18602729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 994 times since January 2019
Visitors: 6708