View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0880_high_11 (Length: 243)

Name: NF0880_high_11
Description: NF0880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0880_high_11
NF0880_high_11
[»] chr3 (1 HSPs)
chr3 (52-123)||(35207134-35207205)


Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 52 - 123
Target Start/End: Complemental strand, 35207205 - 35207134
Alignment:
52 aataccttccctactcaaaaaccatacgccagagaaacaaaacgccaaatccaaattcttctcatattcttc 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35207205 aataccttccctactcaaaaaccatacgccagagaaacaaaacgccaaatccaaattcttctcatattcttc 35207134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 784 times since January 2019
Visitors: 6719