View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0880_low_13 (Length: 315)
Name: NF0880_low_13
Description: NF0880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0880_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 55 - 245
Target Start/End: Complemental strand, 29947879 - 29947689
Alignment:
| Q |
55 |
gctgttgcttcaatgtgtgttcacctggaggtcactaagagaccctttatgggcgaagttgtgcaggctcttaagttgatattcaatgacaacgatgaca |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29947879 |
gctgttgcttcaatgtgtgttcacctggaggtcactaagagaccctttatgggcgaagttgtgcaggctcttaagttgatattcaatgacaacgatggca |
29947780 |
T |
|
| Q |
155 |
tggattgctacagccggaaggaatcttctgatcaagagtctgattttagaggcgacctttctgatagcagttggcggtgtgatgagcctga |
245 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29947779 |
tggatcgctacagccggaaggaatcttctgatcaagagtctgattttagaggcgacctttctgatagcagttggcggtgtgatgagcctga |
29947689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 54 - 145
Target Start/End: Original strand, 39776980 - 39777071
Alignment:
| Q |
54 |
agctgttgcttcaatgtgtgttcacctggaggtcactaagagaccctttatgggcgaagttgtgcaggctcttaagttgatattcaatgaca |
145 |
Q |
| |
|
|||| |||| ||||||||||||||| ||||| || ||||||| |||||||| |||||||||||||||||||| || |||| |||||||| |
|
|
| T |
39776980 |
agctattgcgtcaatgtgtgttcactccgaggtgacacagagaccttttatgggagaagttgtgcaggctcttaaattaatatacaatgaca |
39777071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 132 times since January 2019
Visitors: 6713