View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0880_low_17 (Length: 300)
Name: NF0880_low_17
Description: NF0880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0880_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 29 - 292
Target Start/End: Original strand, 36800043 - 36800305
Alignment:
Q |
29 |
aaaagactccttctttttgaatttcaagcaaa-cattattgggatttggaaggnnnnnnnnnnctcacgtttttggtcttgaacactggatgggtcagtt |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
36800043 |
aaaagactccttctttttgaatttcaagcaaaacattattgggatttgaaaggaaaaaaaaa-ctcacgtttttggtcttgaacactggatgggtcagtt |
36800141 |
T |
 |
Q |
128 |
tgtccattaagatagagaaaaagggcttgatctaattcacccaaatcataagctccagaatctttatttctgctgacataaacnnnnnnnnnnnnngtta |
227 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
36800142 |
tgtccattaagatagagaaaaagggcttgatctaattcacccaaatcataagctccagaatctttatttctgctgacataaacaaaaaacaaaaaagtta |
36800241 |
T |
 |
Q |
228 |
taataacaaaataaaccaannnnnnnnnaacgtaagacacagttaattgttcatcacttcatctc |
292 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
36800242 |
taataacaaaataaaccaa-ttttttttaacgtaagacacagttaattgttcatcacttcatctc |
36800305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1213 times since January 2019
Visitors: 6711