View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0880_low_26 (Length: 279)
Name: NF0880_low_26
Description: NF0880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0880_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 47 - 223
Target Start/End: Original strand, 6316589 - 6316767
Alignment:
| Q |
47 |
atcatcacccaccaaatcaaacagagatatcatatcagactttataaataggaaactaaagatcaatgcaaatagagaaaaataaccatattcactgccg |
146 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316589 |
atcatcacccaccaaatcaagcagagatatcatatcagactttataaataggaaactaaagatcaatgcaaatagagaaaaataaccatattcactgccg |
6316688 |
T |
|
| Q |
147 |
aaaactatatcataacctcagtctgcatcatattgaaaccatattaaccccagacacgtatcgg--ttgtattgtgtct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6316689 |
aaaactatatcataacctcagtctgcatcatattgaaaccatattaaccccagacacgtatcggtattgtattgtgtct |
6316767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 393 times since January 2019
Visitors: 6703