View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0880_low_35 (Length: 220)
Name: NF0880_low_35
Description: NF0880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0880_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 94
Target Start/End: Original strand, 12316395 - 12316472
Alignment:
| Q |
16 |
aatatagataaaaacaaacgattattttatactagttcacaatttaatcgatttgctacctttggtcccctccctcatg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
12316395 |
aatatagataaaaacaaacgattattttatactagttcacaacttaatcggtttgctaccttcggt-ccctccctcatg |
12316472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 650 times since January 2019
Visitors: 6718