View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0880_low_37 (Length: 210)
Name: NF0880_low_37
Description: NF0880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0880_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 40173941 - 40174120
Alignment:
| Q |
1 |
caggcaaagatatcgaacgagagtaagcttgatgagcagaatgctcattaagtgattctgtaacggatgaatcagcgtcctcgtcagaagagcttgaagg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40173941 |
caggcagagatatcgaacgagagtaagcttgatgagcagaatgctcattaagtgattctgtaacggatgaatcagcatcctcgtcagaagagcttgaagg |
40174040 |
T |
|
| Q |
101 |
caacatcacatgaggagttggaaaggttgcagatttattcaaacacaccttgttaggttttgattttttctgtttattaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174041 |
caacatcacatgaggagttggaaaggttgcagatttattcaaacacaccttgttaggttttgattttttctgtttattaa |
40174120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 472 times since January 2019
Visitors: 6704