View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0880_low_4 (Length: 459)
Name: NF0880_low_4
Description: NF0880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0880_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Original strand, 2879393 - 2879769
Alignment:
Q |
1 |
cttggactgggccagtccaatgtgtttcgattatcacggcacgtgggataataataccgactttaatgctgctttgtatgactcgaagtccgaaattagt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2879393 |
cttggactgggccagtccaatgtgtttcgattatcacggtacgtgggataataataccgactttaatgctgctttgtatgactcgaagtccgaaattagt |
2879492 |
T |
 |
Q |
101 |
accaattttggactccactcgtggatcaaatcgggtgttcgacctgaaaagttggttatgggtttggctttatatggacgggcgtgggagcttaaggatc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2879493 |
accaattttggactccactcgtggatcaaatcgggtgttcgacctgaaaagttggttatgggtttggctttatatggacgggcgtgggagcttaaggatc |
2879592 |
T |
 |
Q |
201 |
caaatgtcaatggggtgggagcggaggcagtggggcctgcaactgacacggatggtagtatgaattataatgagattttgaaatttaacaaacagagtgg |
300 |
Q |
|
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2879593 |
caaatgtcaacggggtgggagcggaggcggtggggcctgcaactgacacggatggtagtatgaattataatgagattttgaaatttaacaaacagagtgg |
2879692 |
T |
 |
Q |
301 |
tgctaatgttgtgtatgataaggttgctatatctttttattcttatgcgggtacgacttggatcgggtatgatgatg |
377 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2879693 |
tgctaatgttgtgtatgataaggttgctatatctttttattcttatgcgggtacgacttggatcgggtatgatgatg |
2879769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University