View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0880_low_5 (Length: 399)
Name: NF0880_low_5
Description: NF0880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0880_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 8e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 156 - 365
Target Start/End: Complemental strand, 16156587 - 16156380
Alignment:
| Q |
156 |
cgaataatata-ttgccaccaaatataaagtagtgtttgttaacaacatgaaaattgagattgatagttcatttttgtcactttcttatgacaagaaatg |
254 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
16156587 |
cgaataatatagttgccacgaaatataaagcagtgtttgttaacaacatgaaaatcgagattgatagttaatttttgtcacttttttatgacaagaaatg |
16156488 |
T |
|
| Q |
255 |
tttctactactttagtaagaaaaagttcggcattgctttaggataaggtaaagaattttatcagtgtcttcatccatttctgacaactatgtcataacta |
354 |
Q |
| |
|
||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||||| || ||||||||||||| |
|
|
| T |
16156487 |
ttt---ttgctttagtaagaaaaagttcggcattgctttaggataaggtaaagaatttcatccgtctcttcatccatttctgataattatgtcataacta |
16156391 |
T |
|
| Q |
355 |
aataattaaca |
365 |
Q |
| |
|
||||||||||| |
|
|
| T |
16156390 |
aataattaaca |
16156380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 106 times since January 2019
Visitors: 6700