View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_high_17 (Length: 242)
Name: NF0881_high_17
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0881_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 38763396 - 38763588
Alignment:
| Q |
1 |
caatatttatttgctttctaacaatctaacaaccacatttacaactacacctcttttttatactataaataaatgaatacatttctcaacttcttagttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763396 |
caatatttatttgctttctaacaatctaacaaccacatttacaactacacctcttttttatactataaataaatgaatacatttctcaacttcttagttc |
38763495 |
T |
 |
| Q |
101 |
actctcaattatcaatagtatctcgttgcatgtctcacacttcacattccaattaaagtttcattcactcgttggagcaattagctatattctgagtatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763496 |
actctcaattatcaatagtatctcgttgcatgtc--------------caactaaaagtttcattcactcgttggagcaattagctatattctgagtatg |
38763581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 116 - 187
Target Start/End: Complemental strand, 38762821 - 38762750
Alignment:
| Q |
116 |
tagtatctcgttgcatgtctcacacttcacattccaattaaagtttcattcactcgttggagcaattagcta |
187 |
Q |
| |
|
||||||||| |||||||||||||| ||| ||||||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
38762821 |
tagtatctcattgcatgtctcacaactcaaattccaactacagtttcactctctcgttggagcaattagcta |
38762750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University