View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_2 (Length: 524)
Name: NF0881_low_2
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0881_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 212 - 442
Target Start/End: Complemental strand, 2879040 - 2878810
Alignment:
Q |
212 |
gggaacggtggcggagtgccttgatgaaattctggccccattttttgccggattttgtgatttcaagtttgaaggaaattggttctggttgaatgaaggc |
311 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2879040 |
gggaacggtggcggagtgccttgatgaaattctggccccattttatgccggattttgtgatttcaagtttgaaggaaattggttctggttgaatgaaggc |
2878941 |
T |
 |
Q |
312 |
caataaaatgtgtgtgaagtagtttgtgtcaatcaaagaaggtgaaaaatcatcacctgctggccaatatgctgatctaacaccatggtttaaaaattgg |
411 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2878940 |
caataaaatgtgtgtgaagtagtttgtgtcaatcaaagaaggtgaaaaatcatcacctgctggccaatatgctgatctaacaccatggtttaaaaattgg |
2878841 |
T |
 |
Q |
412 |
tattgcgaattattagaagatgatgatgatg |
442 |
Q |
|
|
|||||||||||||||||||| |||||||||| |
|
|
T |
2878840 |
tattgcgaattattagaagaagatgatgatg |
2878810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 2879393 - 2879602
Alignment:
Q |
1 |
cttggactgggccagtccaatgtgtttcgattatcacggcacgtgggataataataccgactttaatgctgctttgtatgactcgaagtccgaaattagt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2879393 |
cttggactgggccagtccaatgtgtttcgattatcacggtacgtgggataataataccgactttaatgctgctttgtatgactcgaagtccgaaattagt |
2879492 |
T |
 |
Q |
101 |
accaattttggactccactcgtggatcaaatcgggtgttcgacctgaaaagttggttatgggtttggctttatatggacgggcgtgggagcttaaggatc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2879493 |
accaattttggactccactcgtggatcaaatcgggtgttcgacctgaaaagttggttatgggtttggctttatatggacgggcgtgggagcttaaggatc |
2879592 |
T |
 |
Q |
201 |
caaatgtcaa |
210 |
Q |
|
|
|||||||||| |
|
|
T |
2879593 |
caaatgtcaa |
2879602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University