View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0881_low_25 (Length: 305)

Name: NF0881_low_25
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0881_low_25
NF0881_low_25
[»] chr2 (1 HSPs)
chr2 (101-241)||(486946-487086)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 101 - 241
Target Start/End: Original strand, 486946 - 487086
Alignment:
101 cacggcccccttgagatatggtcgaatgaataacatcagtaaagcgtttttctcgggcgtggcgaggctgatggcgttgtgcaccataggtggattctat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||    
486946 cacggcccccttgagatatggtcgaatgaataacatcagtaaagcgtttttctcgggtgtggcgaggctgatggtgttgtacaccataggtggattctat 487045  T
201 aatgcagacatcaggggagaactgtggggtctgtgctgctc 241  Q
    |||||||||||||||||||||||||||||||| ||| ||||    
487046 aatgcagacatcaggggagaactgtggggtctctgcagctc 487086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 51 times since January 2019
Visitors: 6713