View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_25 (Length: 305)
Name: NF0881_low_25
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0881_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 101 - 241
Target Start/End: Original strand, 486946 - 487086
Alignment:
| Q |
101 |
cacggcccccttgagatatggtcgaatgaataacatcagtaaagcgtttttctcgggcgtggcgaggctgatggcgttgtgcaccataggtggattctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
486946 |
cacggcccccttgagatatggtcgaatgaataacatcagtaaagcgtttttctcgggtgtggcgaggctgatggtgttgtacaccataggtggattctat |
487045 |
T |
|
| Q |
201 |
aatgcagacatcaggggagaactgtggggtctgtgctgctc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
487046 |
aatgcagacatcaggggagaactgtggggtctctgcagctc |
487086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 51 times since January 2019
Visitors: 6713