View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_29 (Length: 294)
Name: NF0881_low_29
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0881_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 9 - 274
Target Start/End: Complemental strand, 4769975 - 4769710
Alignment:
| Q |
9 |
gagatgaatctcaaacgcaaataactacacctaattctccgtcatcaccactgtcaccatcgccggcgagattcctccgatatggatctatacaatatcg |
108 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4769975 |
gagaagaatctcaaacgccaataactacacctaattctccgtcatcaccactgtcaccatcgccggcgagattcctccgatatggatctatacaatatcg |
4769876 |
T |
 |
| Q |
109 |
gttggattttaagctctgttttgagtctatttgcgttatacaatttgattttcaccgggaagaagaattatgatgtgaatgagaaggtaaatcagcgtga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4769875 |
gttggattttaagctctgttttgagtctatttgcgttatacaatttgattttcgccgggaagaagaattatgatgtgaatgagaaggtaaatcagcgtga |
4769776 |
T |
 |
| Q |
209 |
ggatagcgtgacgagtactgatgccggtgaaattaaatcggagaaacttaacggtgatgatgatgt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
4769775 |
ggatagcgtgacgagtactgatgccggtgaaattaaatcggacaaacttaacggtgatgctgatgt |
4769710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University