View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_32 (Length: 294)
Name: NF0881_low_32
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0881_low_32 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 64 - 294
Target Start/End: Original strand, 28613064 - 28613294
Alignment:
Q |
64 |
catcatcaacaacaataacactatcaaaattcgcacttgaactagtcccagcttcaccggagtaatcggatacaaacccagttttcttcgcccaagtctt |
163 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28613064 |
catcatcaacaacaataacactatccaaattcgcacttgaactagccccagcttcactggagtaatcggatacaaacccagttttcttcgcccaagtctt |
28613163 |
T |
 |
Q |
164 |
caattctttgggattgtgatctcttcttggaacaaaaggttcaatttttatagcattagaatcttgcttcttcttgttacggacacctctcataaccttc |
263 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
28613164 |
caattctttgggattgtgatctcttcttggaacaaaaggttcaattttaatagcattagaatcttgtttcttcttgttacggacacctctcataaccttc |
28613263 |
T |
 |
Q |
264 |
cccttatcgaaaatatctaagcttgacccag |
294 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
28613264 |
cccttatcgaaaatatctaagcttgacccag |
28613294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 43 times since January 2019
Visitors: 6713