View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_33 (Length: 290)
Name: NF0881_low_33
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0881_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 71 - 240
Target Start/End: Original strand, 21026885 - 21027054
Alignment:
Q |
71 |
catcatctgtaaaatatgtagataggtagattattagatagacaagtgatagaataagataaccatgaggccaaagagcaaattattatgtaattcatga |
170 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
21026885 |
catcatctgtaaaatatgtagataggtagattattagatagacaagtgatagaataagataaccatgaggccaaagagcaaattattatgtaattcacaa |
21026984 |
T |
 |
Q |
171 |
aaatacaacaaattgatttcattgtgtaaaaacaaaattaccagatccaaattcaacatgcaaatatcat |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
21026985 |
aaatacaacaaattgatttcattgtgtaaaaacaaaattaccagatccaaattcaacatgcacatatcat |
21027054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1475 times since January 2019
Visitors: 6712