View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_36 (Length: 279)
Name: NF0881_low_36
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0881_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 24974263 - 24973996
Alignment:
| Q |
1 |
tcatccaagctacatgtggtgttgtattgagtcctaaggatgttgaaaatgggggctcgatggtgtataggtacaagttccaatattccattgaa---ta |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24974263 |
tcatccaagctacatgtggtgttgtattgagtcc----gatgttgaaaatgggggctcgatggtgtataggtacaagttccaatattccattgaaggata |
24974168 |
T |
 |
| Q |
98 |
atccatgggtggaaaatggcagttgtatcttgactgcacatgcaggaaatgcacagtttcagacacgtacattgatgtattgacccatcagaatacgaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24974167 |
atccatgggtggaaaatggcagttgtatcttgactgcaaatacaggaaatgcacagtttcagacacgtacattgatgtattgacccatcagaatacgaaa |
24974068 |
T |
 |
| Q |
198 |
gcttgtaaaccgaatttagtttataatttgtttgaacagaacacagctgatgccatcctcaatacatctctg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24974067 |
gcttgtaaaccgaatttagtttataatttgtttgatcagaacacagctgatgccatcctcaatacatctctg |
24973996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University