View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_37 (Length: 277)
Name: NF0881_low_37
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0881_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 22 - 264
Target Start/End: Original strand, 40670386 - 40670628
Alignment:
| Q |
22 |
catcatcacccaccatccccgtcgcgatctattctccaccatccgtcaccaccaccaccctctacagccgtatccctgttcgccgtcgccgtcaccagca |
121 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
40670386 |
catcctcacccaccatccccgtcgcgatctattctccactatccatcaccaccaccacactctacagtcgtatccccgttcgtcgtcgccgtcaccagca |
40670485 |
T |
 |
| Q |
122 |
ccaccttcgtccgtcatatcactgtcaaaactcgccaccaccaacttcacccaccgtctcaacttcagatctcatcacaaccttcgtcgtcgctgtttca |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40670486 |
ccaccttcgtccgtcatatcactgtcagaactcaccaccaccaacttcacccaccgtctcaccttcagatctcatcacaaccttcgtcgtcgctgtttca |
40670585 |
T |
 |
| Q |
222 |
tcttcggttctcaccactgtcgtcgcccctccgtttcatcttc |
264 |
Q |
| |
|
||||||||||||||||| ||||| || ||||||| |||||||| |
|
|
| T |
40670586 |
tcttcggttctcaccaccgtcgttgctcctccgtctcatcttc |
40670628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 68 - 264
Target Start/End: Original strand, 2916035 - 2916231
Alignment:
| Q |
68 |
caccaccaccaccctctacagccgtatccctgttcgccgtcgccgtcaccagcaccaccttcgtccgtcatatcactgtcaaaactcgccaccaccaact |
167 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2916035 |
caccaccaccacactctacagccgtatccctgttcgtcgtcgccatcaccagcaccaccttcgtccgtcatatcactgtcaaaactcaccaccaccaact |
2916134 |
T |
 |
| Q |
168 |
tcacccaccgtctcaacttcagatctcatcacaaccttcgtcgtcgctgtttcatcttcggttctcaccactgtcgtcgcccctccgtttcatcttc |
264 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2916135 |
tcacccaccgtctcaccttcagatctcatcacaaccttcgtcgtcgctgtttcatcttcggttctcaccactgtcgtcgcccctccgtttcatcttc |
2916231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 22 - 79
Target Start/End: Original strand, 2915956 - 2916013
Alignment:
| Q |
22 |
catcatcacccaccatccccgtcgcgatctattctccaccatccgtcaccaccaccac |
79 |
Q |
| |
|
|||| |||||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
2915956 |
catcctcacccaccatccctgtcgcgatttattctccactatccgtcaccaccaccac |
2916013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 22 - 261
Target Start/End: Original strand, 31859078 - 31859311
Alignment:
| Q |
22 |
catcatcacccaccatccccgtcgcgatctattctccaccatccgtcaccaccaccaccctctacagccgtatccctgttcgccgtcgccgtcaccagca |
121 |
Q |
| |
|
|||| ||||||||||||| ||||||||| ||||||| || |||||||||| ||||||| ||||| | ||||||||| ||||||||||| ||||||| |
|
|
| T |
31859078 |
catcctcacccaccatcctcgtcgcgatttattctcaactatccgtcaccgccaccacactctataaccgtatccccgttcgccgtcgtcgtcacc---- |
31859173 |
T |
 |
| Q |
122 |
ccaccttcgtccgtcatatcactgtcaaaactcgccaccaccaacttcacccaccgtctcaacttcagatctcatcacaaccttcgtcgtcgctgtttca |
221 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||| ||| ||| |||||| |||||||||||| ||||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
31859174 |
--accttcgtccgtcgtatcattgtcagaactcaccagcacaaacttcgcccaccgtctcaccttcagatctcatcacaactttcgtcgccgttgtttca |
31859271 |
T |
 |
| Q |
222 |
tcttcggttctcaccactgtcgtcgcccctccgtttcatc |
261 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||| ||||| |
|
|
| T |
31859272 |
tcttcggttctcaccaccgccgtcgccccttcgtctcatc |
31859311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University