View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0881_low_38 (Length: 277)

Name: NF0881_low_38
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0881_low_38
NF0881_low_38
[»] chr4 (1 HSPs)
chr4 (29-121)||(42239990-42240082)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 29 - 121
Target Start/End: Complemental strand, 42240082 - 42239990
Alignment:
29 gacatatttatagcaattaagcatttcatggggagataaacgaactttgggttggatcttgtactcatagaaggggtataagcgtttgatttc 121  Q
    ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
42240082 gacatctttatagcaattaagcatttcatggagagataaacgaactttgggttggatcttgtactcatcgaaggggtataagcgtttgatttc 42239990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University