View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_45 (Length: 259)
Name: NF0881_low_45
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0881_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 239
Target Start/End: Complemental strand, 40485057 - 40484823
Alignment:
| Q |
5 |
cagatatagacgcagagcataactttttgaaccaatttttctttagaagtccaacacattacactgcagattgaaaaatattattatatacaagatttta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40485057 |
cagatatagacgcagagcataactttttgaaccaatttttctttagaagtccaacacattccactgcagattgaaaaatattattatatacaagatttta |
40484958 |
T |
|
| Q |
105 |
taacaaactatagaataacttctatattgtgatgtgagcttgtcctttggcaaatggctggttataatttataaattaatctcttcataactaaacctca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40484957 |
taacaaactatagaataacttctatattgtgatgtgagcttgccatttggcaaatggctggttataatttataaattaatctcttcataactaaacctca |
40484858 |
T |
|
| Q |
205 |
agaaaaagctactcttcagctaaatatgatgatgt |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40484857 |
agaaaaagctactgttcagctaaatatgatgatgt |
40484823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 981 times since January 2019
Visitors: 6719