View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_46 (Length: 256)
Name: NF0881_low_46
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0881_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 246
Target Start/End: Complemental strand, 3929337 - 3929120
Alignment:
| Q |
29 |
gtattttgattctcaatagcttttgtatagtgtagaggcaattctcaagacataattgttgagtaaatcatcaagcttgtctttgactttgtagggcgct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3929337 |
gtattttgattctcaatagcttttgtatagtgtagaggcaattctcaagacataattgttgagtaaatcaccaagcttgtctttgactttgtagggcgct |
3929238 |
T |
|
| Q |
129 |
ctcaaatatgtcaaattagtatttgatcctgtcaaattttacgtccatccttcatttaacccctgttgattaatgtcgttccatccttccaccactgtcg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3929237 |
ctcaaatatgtcaaattagtatttgatcctgtcaaattttacttccatccttcagttaacgcctgttgattaatgtcattccatccttccaccactgtca |
3929138 |
T |
|
| Q |
229 |
attcgttccctatattct |
246 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
3929137 |
attcgctccctatattct |
3929120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 799 times since January 2019
Visitors: 6719