View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0881_low_53 (Length: 251)

Name: NF0881_low_53
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0881_low_53
NF0881_low_53
[»] scaffold0002 (1 HSPs)
scaffold0002 (1-213)||(401525-401737)


Alignment Details
Target: scaffold0002 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 401737 - 401525
Alignment:
1 aatacattggcgtcaagtcctacccagattctttaaataatttcccagctgatattatcggccgccacatccctgaattccatttcattttgggctttgc 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
401737 aatacattggcgtgaagtcctacccagattctttaaataatttcccagctgatattatcggccgccacatccctgaattccatttcattttgggctttgc 401638  T
101 ccatgagacttacgtcgatggaaaaggcaccggaattttcaacgccagttggaagattcctttcttcagtccagacaatgttgatgttctcaagaacaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| | |||||| ||||    
401637 ccatgagacttacgtcgatggaaaaggcaccggaattttcaacgccagttggaagattcctttctttggtccagacaatgttgatgatatcaagaccaac 401538  T
201 catcgcaatgtga 213  Q
    ||| |||||||||    
401537 catggcaatgtga 401525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University