View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_53 (Length: 251)
Name: NF0881_low_53
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0881_low_53 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 401737 - 401525
Alignment:
| Q |
1 |
aatacattggcgtcaagtcctacccagattctttaaataatttcccagctgatattatcggccgccacatccctgaattccatttcattttgggctttgc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401737 |
aatacattggcgtgaagtcctacccagattctttaaataatttcccagctgatattatcggccgccacatccctgaattccatttcattttgggctttgc |
401638 |
T |
|
| Q |
101 |
ccatgagacttacgtcgatggaaaaggcaccggaattttcaacgccagttggaagattcctttcttcagtccagacaatgttgatgttctcaagaacaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |||| |
|
|
| T |
401637 |
ccatgagacttacgtcgatggaaaaggcaccggaattttcaacgccagttggaagattcctttctttggtccagacaatgttgatgatatcaagaccaac |
401538 |
T |
|
| Q |
201 |
catcgcaatgtga |
213 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
401537 |
catggcaatgtga |
401525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 878 times since January 2019
Visitors: 6719