View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_54 (Length: 251)
Name: NF0881_low_54
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0881_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 12954267 - 12954490
Alignment:
Q |
1 |
aagcttcaatttttacacaaaaccccnnnnnnngggactttttctttccatttactcgttcaaatttctatatttttgaccaattgggtcaatttcgacc |
100 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12954267 |
aagcttcaatttttacacaaaacccctttttttgggactttttctttccatttacccgttcaaatttctatatttttgaccaattgggtcaatttcgacc |
12954366 |
T |
 |
Q |
101 |
tgatccagttataatcgtgttgaattgtctgaaactgatttcaattttgtgtgaagtttggaaataaagaagggtatgttttctacctcttagataggtt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
12954367 |
tgatccagttataatcgtgttgaattgtctgaaactgatttcaattttgtgtgaagtttggaaataaagaagggtatgttttctacctcttatataggtt |
12954466 |
T |
 |
Q |
201 |
ttagggttaattttggtgctgttg |
224 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
12954467 |
ttagggttaattttggtgctgttg |
12954490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University