View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0881_low_57 (Length: 246)

Name: NF0881_low_57
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0881_low_57
NF0881_low_57
[»] chr3 (2 HSPs)
chr3 (147-229)||(39057650-39057732)
chr3 (38-105)||(39057541-39057608)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 147 - 229
Target Start/End: Original strand, 39057650 - 39057732
Alignment:
147 caatcctctgtatttgggtgttcaaccatgaaaatggaggatgaattttctggtttgatttatgatttttactgtgatgatgt 229  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39057650 caatcctctgtttttgggtgttcaaccatgaaaatggaggatgaattttctggtttgatttatgatttttactgtgatgatgt 39057732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 38 - 105
Target Start/End: Original strand, 39057541 - 39057608
Alignment:
38 ctggttgcgtattcagcaagtgttcttgttgaattgaatgaattatcttaataataattctctgatct 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||    
39057541 ctggttgcgtattcagcaagtgttcttgttgaattgaatgaattaccttaattataattctctgatct 39057608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University