View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0881_low_57 (Length: 246)
Name: NF0881_low_57
Description: NF0881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0881_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 147 - 229
Target Start/End: Original strand, 39057650 - 39057732
Alignment:
Q |
147 |
caatcctctgtatttgggtgttcaaccatgaaaatggaggatgaattttctggtttgatttatgatttttactgtgatgatgt |
229 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39057650 |
caatcctctgtttttgggtgttcaaccatgaaaatggaggatgaattttctggtttgatttatgatttttactgtgatgatgt |
39057732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 38 - 105
Target Start/End: Original strand, 39057541 - 39057608
Alignment:
Q |
38 |
ctggttgcgtattcagcaagtgttcttgttgaattgaatgaattatcttaataataattctctgatct |
105 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
39057541 |
ctggttgcgtattcagcaagtgttcttgttgaattgaatgaattaccttaattataattctctgatct |
39057608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University