View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0882_high_3 (Length: 348)
Name: NF0882_high_3
Description: NF0882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0882_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 31 - 340
Target Start/End: Complemental strand, 44779735 - 44779427
Alignment:
| Q |
31 |
cttataatattttcctttaatatctttcagatatgtttagattaatggaatagaataaatttatgtttcgctgtttggataaagtagaacatattatatc |
130 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
44779735 |
cttataacattttcctttaatatctttcagatatgtttaaattaatggaatagaataaatttatgtttcgctgtttggataaagtggaatatattatatt |
44779636 |
T |
 |
| Q |
131 |
ttatttcactggtaaccctcacttatgttccccaccaatttttgagaaatttaacacaatcccttttatttgattttttaacttaccataaacaccgtta |
230 |
Q |
| |
|
||||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44779635 |
ttatttcaccgataaccctcacttatgtcccccaccaatttttgagaaatttaacacaatcccttttatttgattttttaac-taccataaacaccgtta |
44779537 |
T |
 |
| Q |
231 |
tctgtttcattctttcgcattcggcatcacacaaatgacactaataattttgcaatggtattttttgctttcaacaattgttgagaaaatttctttgcat |
330 |
Q |
| |
|
| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44779536 |
tatgtttaattctttcgtattcggcatcacacaaatgacactaataattttgcaatggtattttttgctttcaacaattgttgagaaaatttctttgcat |
44779437 |
T |
 |
| Q |
331 |
cacctatgct |
340 |
Q |
| |
|
|||||||||| |
|
|
| T |
44779436 |
cacctatgct |
44779427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University