View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0882_low_14 (Length: 292)
Name: NF0882_low_14
Description: NF0882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0882_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 12316303 - 12316343
Alignment:
| Q |
1 |
gtaaaactcattttacgattcatttcaatacctttcaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12316303 |
gtaaaactcattttacgattcatttcaatacctttcaattt |
12316343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 107 - 166
Target Start/End: Original strand, 12316414 - 12316472
Alignment:
| Q |
107 |
gattattttatactagttcacaatttaatcgatttgctacctttggtcccctccctcatg |
166 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
12316414 |
gattattttatactagttcacaacttaatcggtttgctaccttcggt-ccctccctcatg |
12316472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 402 times since January 2019
Visitors: 6714