View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0882_low_16 (Length: 281)
Name: NF0882_low_16
Description: NF0882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0882_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 30 - 271
Target Start/End: Complemental strand, 548239 - 547998
Alignment:
Q |
30 |
caaacacgcccttttcttcctcgcctcttcattagatttactaacctcacctcccttaacctcacttgctttggtggtgatctcgatgggcttctatgtg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
548239 |
caaacacgcccttttcttcctcgcctcttcattagatttactaacctcacctcccttaacctcacttgctttggtggtgatctcgatgggcttctatgtg |
548140 |
T |
 |
Q |
130 |
taatctcttgttttcgattgaaccaccttacatcgctcaatctctctaaccaacccttcattcccacaaatggcttgcaagtcttcgcacgaaagtttac |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
548139 |
taatctcttgttttcgattgaaccaccttacatcgctcaatctctctaaccaacccttcattcccacaaatggcttgcaagtcttcgcacgaaagtttac |
548040 |
T |
 |
Q |
230 |
aactttgaactctctcacttgttccaacattgattctctctg |
271 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
548039 |
aactttgaactctctcacttgttccaacattgattctctctg |
547998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 154 - 262
Target Start/End: Original strand, 8186315 - 8186423
Alignment:
Q |
154 |
accttacatcgctcaatctctctaaccaacccttcattcccacaaatggcttgcaagtcttcgcacgaaagtttacaactttgaactctctcacttgttc |
253 |
Q |
|
|
|||| ||||| ||||||||||||||| ||||| |||||| ||||||| |||| ||| || | ||||| |||||||||||| ||| ||||| ||||| |
|
|
T |
8186315 |
acctcacatcactcaatctctctaacaaacccaccattcctgcaaatggattgcgagttctctcccgaaatattacaactttgacctcactcacatgttc |
8186414 |
T |
 |
Q |
254 |
caacattga |
262 |
Q |
|
|
||||||||| |
|
|
T |
8186415 |
caacattga |
8186423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 156 - 259
Target Start/End: Complemental strand, 1755651 - 1755548
Alignment:
Q |
156 |
cttacatcgctcaatctctctaaccaacccttcattcccacaaatggcttgcaagtcttcgcacgaaagtttacaactttgaactctctcacttgttcca |
255 |
Q |
|
|
||||||||| | |||||||| ||||||| | ||||||||| || || ||||||| ||| | | |||| |||||||||||| ||||||||| ||||||| |
|
|
T |
1755651 |
cttacatcgtttaatctctccaaccaacacgccattcccaccaaagggttgcaagctttctctcaaaagattacaactttgacctctctcacatgttcca |
1755552 |
T |
 |
Q |
256 |
acat |
259 |
Q |
|
|
|||| |
|
|
T |
1755551 |
acat |
1755548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 55907703 - 55907745
Alignment:
Q |
226 |
ttacaactttgaactctctcacttgttccaacattgattctct |
268 |
Q |
|
|
||||||||||||| ||||||| |||||||||||||| |||||| |
|
|
T |
55907703 |
ttacaactttgaattctctcatttgttccaacattgcttctct |
55907745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 3437643 - 3437691
Alignment:
Q |
221 |
aaagtttacaactttgaactctctcacttgttccaacattgattctctc |
269 |
Q |
|
|
|||| |||||||||||| |||||||| |||||||||| |||||| |||| |
|
|
T |
3437643 |
aaagattacaactttgacctctctcagttgttccaactttgattttctc |
3437691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 261
Target Start/End: Original strand, 21833244 - 21833340
Alignment:
Q |
165 |
ctcaatctctctaaccaacccttcattcccacaaatggcttgcaagtcttcgcacgaaagtttacaactttgaactctctcacttgttccaacattg |
261 |
Q |
|
|
|||||| |||| ||| ||||| ||||||| || |||| |||| ||| || |||| ||| |||| ||||||| |||||||||||||||||| |||| |
|
|
T |
21833244 |
ctcaatatctccaacaaacccaccattcccgcagatgggttgcgagtttttgcacaaaacattactactttgacctctctcacttgttccaaaattg |
21833340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 263
Target Start/End: Original strand, 51763382 - 51763455
Alignment:
Q |
190 |
ttcccacaaatggcttgcaagtcttcgcacgaaagtttacaactttgaactctctcacttgttccaacattgat |
263 |
Q |
|
|
|||| |||||||| |||| ||| || ||| |||| |||||||||||| ||||||||||||||| |||||||| |
|
|
T |
51763382 |
ttcctacaaatgggttgcgagttttttcacaaaagattacaactttgacatctctcacttgttcccacattgat |
51763455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University