View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0882_low_8 (Length: 384)
Name: NF0882_low_8
Description: NF0882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0882_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 43859153 - 43858970
Alignment:
| Q |
13 |
tgagacggaggaagtacgttctaaataacttgggtaatgaccaactctattactatgacatgtgcagaggcatttgattcctgataggagtgaactttag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43859153 |
tgagacggaggaagtacgttctaaataacttgggtaatgactaactctattactatgacatgtgcagaggcatttgattcctgataggagtgaactttag |
43859054 |
T |
 |
| Q |
113 |
tcacccactttattctacatttccacgaaacgcttgggttgatggtcctaattggggttaaaagatgacatggacggcaaaaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43859053 |
tcacccactttattctacatttccacgaaacgcttgggttgttggtcctaattggggttaaaagatgacttggacggcaaaaaa |
43858970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 260 - 302
Target Start/End: Complemental strand, 43858968 - 43858926
Alignment:
| Q |
260 |
aaatgatcattcaacttatcccactagtaagtgctgatgatgt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43858968 |
aaatgatcattcaacttatcccactagtaagtgctgatgatgt |
43858926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University