View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_high_8 (Length: 344)
Name: NF0883_high_8
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0883_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 174 - 265
Target Start/End: Complemental strand, 31835543 - 31835452
Alignment:
| Q |
174 |
aagtattgcttaggtatttagattttgtaaattacttcacttattggagtatggtcaaatctctttttagtacttcttccatcctatattat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||| | ||||||||| |
|
|
| T |
31835543 |
aagtattgcttaggtatttagattttgtaaattacttcgcttattggagtatggtcatatttctttttagtacttcttccgttctatattat |
31835452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 36 - 106
Target Start/End: Complemental strand, 31835682 - 31835611
Alignment:
| Q |
36 |
aaatttagtggcgatcgaaaattatctaccaacaagtctagaaaggtttttaaaat-ggagggtgaataatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31835682 |
aaatttagtggcgatcgaaaattatctaccaacaagtctagaaaggtttttaaaatgggagggtgaataatg |
31835611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University