View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_high_9 (Length: 313)
Name: NF0883_high_9
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0883_high_9 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 216 - 313
Target Start/End: Complemental strand, 29405152 - 29405055
Alignment:
| Q |
216 |
gacacgttggtggaattcttgcgtgatagttgtggtcgtagatttcctccgccagaattctcaggggaatctgccgtgaaccgagttgagctcccacg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29405152 |
gacacgttggtggaattcttgcgtgatagttgtggtcgtagatttcctccgccagaattctcagaggaatctgccgtgaaccgagttgagctcccacg |
29405055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 75 - 196
Target Start/End: Complemental strand, 29405419 - 29405289
Alignment:
| Q |
75 |
cttaatatataccttgacccttccaaccccatctctctatcagtctcccctaacaaatccatcaacgacatcgtcggaggtcc---tgcagcctcg---- |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29405419 |
cttaatatataccttgacccttccaaccccatctctctatcagtctcccctaacaaatccatcaacgacatcgtcggaggtcctgttgcagcctcggcct |
29405320 |
T |
 |
| Q |
168 |
--gcctcagcctccgctgcagcttctgctgc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29405319 |
cagcctcagcctccgctgcagcttctgctgc |
29405289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 19911382 - 19911422
Alignment:
| Q |
82 |
tataccttgacccttccaaccccatctctctatcagtctcc |
122 |
Q |
| |
|
|||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
19911382 |
tataccttgatccttccaatcccatctccctatcagtctcc |
19911422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University