View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_11 (Length: 359)
Name: NF0883_low_11
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0883_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 95 - 354
Target Start/End: Original strand, 35793535 - 35793794
Alignment:
| Q |
95 |
cttatgactcttctcatatttatggttaagactgtgactggacatttatgctatatggataacaacaagctttgcatgaattggtaactttttcaattga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35793535 |
cttatgactcttctcatatttatggttaagactgtgaccggacatttatgctatatggataacaacaagctttgcatgaattggtaactttttcaattga |
35793634 |
T |
|
| Q |
195 |
aactcaccattttggatgaacgtttggttgaagtttgcattgaatgaccatttgaacgtgctgtagaggcaaagcagacagaggtatagagactatagat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35793635 |
aactcaccattttggatgaacgtttggttgaagtttgcattgaatgaccatttgaacgtgctgtagaggcaaagcagacagaggtatagagactatagat |
35793734 |
T |
|
| Q |
295 |
atcaatttcattatactgtttgagtacttcatcaactgcttgatcacaatcttcattttt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35793735 |
atcaatttcattatactgtttgagtacttcatcaactgcttgatcacaatcttcattttt |
35793794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 8349382 - 8349318
Alignment:
| Q |
263 |
gcaaagcagacagaggtatagagactatagatatcaatttcattatactgtttgagtacttcatc |
327 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
8349382 |
gcaaagcagacagaggtatacaggctgtagatatcaatttcattgtactgtttgagcacttcatc |
8349318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 263 - 327
Target Start/End: Original strand, 42820239 - 42820303
Alignment:
| Q |
263 |
gcaaagcagacagaggtatagagactatagatatcaatttcattatactgtttgagtacttcatc |
327 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
42820239 |
gcaaagcagacagaggtatacaggctgtagatatcaatttcattgtactgtttgagcacttcatc |
42820303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 3333681 - 3333617
Alignment:
| Q |
263 |
gcaaagcagacagaggtatagagactatagatatcaatttcattatactgtttgagtacttcatc |
327 |
Q |
| |
|
||||||||||| ||||||||||| || || |||||||||||||| |||||||| || |||||||| |
|
|
| T |
3333681 |
gcaaagcagactgaggtatagaggctgtaaatatcaatttcattgtactgtttaagcacttcatc |
3333617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 621 times since January 2019
Visitors: 6718