View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_12 (Length: 350)
Name: NF0883_low_12
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0883_low_12 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 75 - 350
Target Start/End: Complemental strand, 29405419 - 29405135
Alignment:
Q |
75 |
cttaatatataccttgacccttccaaccccatctctctatcagtctcccctaacaaatccatcaacgacatcgtcggaggtcctg---cagcctcggcct |
171 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
29405419 |
cttaatatataccttgacccttccaaccccatctctctatcagtctcccctaacaaatccatcaacgacatcgtcggaggtcctgttgcagcctcggcct |
29405320 |
T |
 |
Q |
172 |
cagcctc------cgctgcagcttctgctgcttcttgtgccgccactgcttctctcgccgataatgccctccccgtctctggatgcttggtatcatcgtc |
265 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29405319 |
cagcctcagcctccgctgcagcttctgctgcttcttgtgccgccactgcttctctcgccgataatgccctccccgtctctggatgcttggtatcatcgtc |
29405220 |
T |
 |
Q |
266 |
gggctcctcatcgtcgaagctgtctcgaaaagtcactacacgcccttttcggaatggatctgccgatgacacgttggtggaattc |
350 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29405219 |
gggctcctcatcgtcgaagctgtctcgaaaagtcactacacgcccttttcggaatggatctgccgatgacacgttggtggaattc |
29405135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 19911382 - 19911422
Alignment:
Q |
82 |
tataccttgacccttccaaccccatctctctatcagtctcc |
122 |
Q |
|
|
|||||||||| |||||||| |||||||| |||||||||||| |
|
|
T |
19911382 |
tataccttgatccttccaatcccatctccctatcagtctcc |
19911422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 229 times since January 2019
Visitors: 6714