View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_13 (Length: 344)
Name: NF0883_low_13
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0883_low_13 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 22 - 344
Target Start/End: Complemental strand, 29405466 - 29405135
Alignment:
Q |
22 |
catcatcaccttcctcataatcatcatcagaaaaatcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcccctaa |
121 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29405466 |
catcttcaccttcctcataatcatcatcagaaaaatcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcccctaa |
29405367 |
T |
 |
Q |
122 |
caaatccatcaacgacatcgtcggaggtcctg---cagcctcggcctcagcctc------cgctgcagcttctgctgcttcttgtgccgccactgcttct |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29405366 |
caaatccatcaacgacatcgtcggaggtcctgttgcagcctcggcctcagcctcagcctccgctgcagcttctgctgcttcttgtgccgccactgcttct |
29405267 |
T |
 |
Q |
213 |
ctcgccgataatgccctccccgtctctggatgcttggtatcatcgtcgggctcctcatcgtcgaagctgtctcgaaaagtcactacacgcccttttcgga |
312 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29405266 |
ctcgccgataatgccctccccgtctctggatgcttggtatcatcgtcgggctcctcatcgtcgaagctgtctcgaaaagtcactacacgcccttttcgga |
29405167 |
T |
 |
Q |
313 |
atggatctgccgatgacacgttggtggaattc |
344 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
29405166 |
atggatctgccgatgacacgttggtggaattc |
29405135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 57 - 116
Target Start/End: Original strand, 19911363 - 19911422
Alignment:
Q |
57 |
tcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcc |
116 |
Q |
|
|
||||| |||||||| || |||||||||| |||||||| |||||||| |||||||||||| |
|
|
T |
19911363 |
tcttcttcatcactcaaagtataccttgatccttccaatcccatctccctatcagtctcc |
19911422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University