View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_15 (Length: 340)
Name: NF0883_low_15
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0883_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 2e-28; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 110
Target Start/End: Complemental strand, 30481913 - 30481834
Alignment:
| Q |
30 |
tactggtaggatctctatttccccttcttatgtttggatttcaactgctcaaaaatctttatttttaattctcgttgttga |
110 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30481913 |
tactggtaagatctcaatttccccttcttatgtttggatttcaactgctcaaaaatctttattttt-attctcgttgttga |
30481834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 110
Target Start/End: Original strand, 30714608 - 30714687
Alignment:
| Q |
30 |
tactggtaggatctctatttccccttcttatgtttggatttcaactgctcaaaaatctttatttttaattctcgttgttga |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30714608 |
tactggtaggatctctatttacccttcttatgtttgcatttcaactgctcaaaaatctttattttt-attctcgttgttga |
30714687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 30 - 96
Target Start/End: Complemental strand, 30058878 - 30058812
Alignment:
| Q |
30 |
tactggtaggatctctatttccccttcttatgtttggatttcaactgctcaaaaatctttattttta |
96 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30058878 |
tactggtaggatctcaatttccccttcttatgtttggatttcaactgctcaaaaatctttattttta |
30058812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 30 - 96
Target Start/End: Original strand, 30678765 - 30678831
Alignment:
| Q |
30 |
tactggtaggatctctatttccccttcttatgtttggatttcaactgctcaaaaatctttattttta |
96 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30678765 |
tactggtaggatctcaatttccccttcttatgtttggatttcaactgctcaaaaatctttattttta |
30678831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 30 - 96
Target Start/End: Complemental strand, 29870767 - 29870701
Alignment:
| Q |
30 |
tactggtaggatctctatttccccttcttatgtttggatttcaactgctcaaaaatctttattttta |
96 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29870767 |
tacttgtaggatctcaatttccccttcttatgtttggatttcaactgctcaaaaatctttattttta |
29870701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 210 - 247
Target Start/End: Complemental strand, 30493468 - 30493431
Alignment:
| Q |
210 |
ttgtctgatatctaatatgccattgtgaatacacatgt |
247 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30493468 |
ttgtctgatatcaaatatgccattgtgaatacacatgt |
30493431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 29851882 - 29851832
Alignment:
| Q |
30 |
tactggtaggatctctatttccccttcttatgtttggatttcaactgctcaa |
81 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
29851882 |
tactggtaggctctctattttcc-ttcttatatttggatttcaactgctcaa |
29851832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 116 - 161
Target Start/End: Complemental strand, 29870649 - 29870604
Alignment:
| Q |
116 |
acatgaaagatattttactgttctacctaagattgataaatgttct |
161 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
29870649 |
acatgaaagatattttactgttcatcctaagaaggataaatgttct |
29870604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 20298255 - 20298318
Alignment:
| Q |
33 |
tggtaggatctctatttccccttcttatgtttggatttcaactgctcaaaaatctttattttta |
96 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
20298255 |
tggtaggatctctatttcctattcttatgtttggatttcaactactcaaaattttttattttta |
20298318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 33 - 81
Target Start/End: Complemental strand, 26705839 - 26705791
Alignment:
| Q |
33 |
tggtaggatctctatttccccttcttatgtttggatttcaactgctcaa |
81 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
26705839 |
tggtacgatctctgtttccccttcttatgtttggatttcaactgttcaa |
26705791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 168 times since January 2019
Visitors: 6713