View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_20 (Length: 294)
Name: NF0883_low_20
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0883_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 47835177 - 47835463
Alignment:
| Q |
1 |
tcatcactgctctacacactgccacaccttgtcttgttttgggccatgccaatacattaacaattaccctattctctcttgctctannnnnnnctttcat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47835177 |
tcatcactgctctaaacactgccacaccttgtcttgttttgggccatgtcaatagattaacaattaccctattctctcttgctctctttttttctttcat |
47835276 |
T |
 |
| Q |
101 |
gtgataataaagtgatacataccacttcacttcacttc-----ccatcactcacagtcacagtattgaaactcacactttgtttgcgnnnnnnngtggta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47835277 |
gtgataataaagtgatacataccacttcacttcacttcacttcccatcactcacagtcacagtattgaaactcacactttgtttgcgtttttttgtggta |
47835376 |
T |
 |
| Q |
196 |
aagttagaaaacacaacacattctttctatctagtttcattccatttccagcaagcaattgcattgcatctaccaacaatttaccta |
282 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47835377 |
aagtaagaaaacacaacacattctttctatctagtttcattccatttccagcaagcaattgcattgcatctaccaacaatttaccta |
47835463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University