View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_21 (Length: 293)
Name: NF0883_low_21
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0883_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 62 - 135
Target Start/End: Original strand, 9945722 - 9945795
Alignment:
| Q |
62 |
catcacctttccacacttttaaccctccaccacctcattccatcaaatctccaccaccagcaccatctcattca |
135 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9945722 |
catcacctttccacccttttaaccctccaccacctcattccatcaaatctccaccaccagcaccatctcattca |
9945795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 704 times since January 2019
Visitors: 6719