View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_26 (Length: 252)
Name: NF0883_low_26
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0883_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 55101864 - 55102103
Alignment:
| Q |
1 |
attcttacttcaggctagaataaattcttcaagaacttgaaattgtctgaataggatta---ttattattattttgattcatttacatatgcaatataat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55101864 |
attcttacttcaggctagaataaattcttcaagaacttgaaattgtctgaataggattattattattattattttgattcatttacatatgcaatataat |
55101963 |
T |
 |
| Q |
98 |
tgagtgtttccaattccacaggcaagggtgactcttgaaaaccatcatcaatatcggcatgtagacaaaccagggtggaaactaggatggacatgggcta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55101964 |
tgagtgtttccaattccacaggcaagggtgactcttgaaaaccatcatcaatatcggcatgtagacaaaccagggtggaaactaggatggacatgggcta |
55102063 |
T |
 |
| Q |
198 |
ataaggaggtgatatggtcaatgagtggtgcaattgcaac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55102064 |
ataaggaggtgatatggtcaatgagtggtgcaattgcaac |
55102103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University