View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_30 (Length: 231)
Name: NF0883_low_30
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0883_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 6 - 198
Target Start/End: Complemental strand, 48942790 - 48942588
Alignment:
Q |
6 |
acctttttcccaccaaaaaccaccattatcgtttccgtctgaagtttcggtagtgactagtgaag----------tttgagcttggaacagagaaatgag |
95 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
T |
48942790 |
acctttttcccaccgaaaaccaccattatcgtttccgtctgaagtttcggtagtgactagtgaagggaagtgaagtttgagcttgaaacagagaaatgag |
48942691 |
T |
 |
Q |
96 |
aatgaggaaaaataaaaatcagagtaaaaacgacggcgttttgtgagtgaagagcatgggtgacacgtgttaatttgtgtgtgtagatagataagacgag |
195 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48942690 |
aatgaggaaaaataaaaatcagagtaaaaacgacggcgttttgtgagtgaagagcatgggtgacacgtgttaatttgtgtgtgtagatagataagacgag |
48942591 |
T |
 |
Q |
196 |
tag |
198 |
Q |
|
|
||| |
|
|
T |
48942590 |
tag |
48942588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University