View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0883_low_31 (Length: 218)
Name: NF0883_low_31
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0883_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 43574733 - 43574826
Alignment:
| Q |
1 |
cttcacagtggcttcatttaaagacaaaacctgtgtgaaaaatgccgctccgattgttgattcctgcacacattaatttaaggtaatccaaatt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
43574733 |
cttcacagtggcttcatttaaagacaaaacctgtgtgaaaaatgcggctccgattgttgattcctgcacacattcatttaaggtaattcaaatt |
43574826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University