View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0884_high_5 (Length: 313)
Name: NF0884_high_5
Description: NF0884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0884_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 98 - 276
Target Start/End: Complemental strand, 40835510 - 40835332
Alignment:
Q |
98 |
acaataatggtcatttttacaattatctaataaagttattttggcaccttcatttccatgatcaaaatatggtagtaattgttgaatgtttcttttttct |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40835510 |
acaataatggtcatttttacaattatctaataaagttattttggcaccttcatttccatgatcaaaatatggtagtaattgttgaatgtttcttttttct |
40835411 |
T |
 |
Q |
198 |
ggatgtgatgattgtgattttgtcacatttcaaatttagtaatcatattgtctatacaatttatttatttatgatgatg |
276 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40835410 |
ggatatgatgattgtgattttgtcacatttcaaatttagtaatcatattgtctatacaatttatttatttatgatgatg |
40835332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 40835605 - 40835541
Alignment:
Q |
9 |
agcagagataaatttcaagaaagattggatttcaagttctatgatttcaaggctcttgaggtttt |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40835605 |
agcagagataaatttcaagaaagattggatttcaagttctatgatttcaaggctcttgaggtttt |
40835541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 120 times since January 2019
Visitors: 6702