View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0884_high_6 (Length: 309)

Name: NF0884_high_6
Description: NF0884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0884_high_6
NF0884_high_6
[»] chr8 (1 HSPs)
chr8 (30-303)||(16496864-16497136)


Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 30 - 303
Target Start/End: Complemental strand, 16497136 - 16496864
Alignment:
30 gattttgtggtttttgttgaagattgccttatgcatgctaaacatcataatataagataaacctaaacaaaatgaacattatatgaagactttgtcacaa 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
16497136 gattttgtggtttttgttgaagattgccttatgcatgctaaacatcataatataagataa-cctaaacaaaatgaacattatatgaagactttgtcacaa 16497038  T
130 cctgatttaaaacaagaacaattagaatgatttacatcttgaaagaagtactcaacacataaagaacaaaattacaagtcatatgcatatatggaaaacc 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16497037 cctgatttaaaacaagaacaattagaatgatttacatcttgaaagaagtactcaacacataaagaacaaaattacaagtcatatgcatatatggaaaacc 16496938  T
230 tattagatttcggtagattgtagaaattataaaaatcaaacatatcaatgataaataactattagtataatcta 303  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||    
16496937 tattagatttcagtagattgtagaaattataaaaatcaaacatagcaatgataaataactattagcataatcta 16496864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 19 times since January 2019
Visitors: 6713