View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0884_high_7 (Length: 255)
Name: NF0884_high_7
Description: NF0884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0884_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 7 - 251
Target Start/End: Original strand, 16496648 - 16496892
Alignment:
Q |
7 |
tccaataatatctcaagatttgcttcgaacatcttctctgcttcaaaccttaattattcttccaatcgcaacaaaacttgggatcttctctgcttcaatt |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16496648 |
tccaataatatctcaagatttgcttcgaacatcttctctgcttcaaaccttaattattcttccaatcgcaacaaaacttgggatcttctctgcttcaatt |
16496747 |
T |
 |
Q |
107 |
tctctgaaaagtgggttatagatgtaagtgctatggtgttaaaagtaaatttggacgttgttgtggtgatgaggataaacatgaagtttagatgaccatc |
206 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
16496748 |
tctctgaagagtgggttatagatgtaagtgttatggtgttaaaagtaaatttggacgttgttgtggtgatgaggataataatgaagtttagatgaccatc |
16496847 |
T |
 |
Q |
207 |
gaccatttagtgtagttagattatgctaatagttatttatcattg |
251 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
16496848 |
gaccatttagtatagttagattatgctaatagttatttatcattg |
16496892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1237 times since January 2019
Visitors: 6711