View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0884_low_10 (Length: 309)
Name: NF0884_low_10
Description: NF0884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0884_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 30 - 303
Target Start/End: Complemental strand, 16497136 - 16496864
Alignment:
| Q |
30 |
gattttgtggtttttgttgaagattgccttatgcatgctaaacatcataatataagataaacctaaacaaaatgaacattatatgaagactttgtcacaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16497136 |
gattttgtggtttttgttgaagattgccttatgcatgctaaacatcataatataagataa-cctaaacaaaatgaacattatatgaagactttgtcacaa |
16497038 |
T |
 |
| Q |
130 |
cctgatttaaaacaagaacaattagaatgatttacatcttgaaagaagtactcaacacataaagaacaaaattacaagtcatatgcatatatggaaaacc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16497037 |
cctgatttaaaacaagaacaattagaatgatttacatcttgaaagaagtactcaacacataaagaacaaaattacaagtcatatgcatatatggaaaacc |
16496938 |
T |
 |
| Q |
230 |
tattagatttcggtagattgtagaaattataaaaatcaaacatatcaatgataaataactattagtataatcta |
303 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
16496937 |
tattagatttcagtagattgtagaaattataaaaatcaaacatagcaatgataaataactattagcataatcta |
16496864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University