View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0884_low_17 (Length: 251)
Name: NF0884_low_17
Description: NF0884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0884_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 22597254 - 22597479
Alignment:
| Q |
17 |
catcatcatcatcttcattgtcaggttgagctattggattttggtcaatactctcctaaaaaatgagaatgcaagagcacaataagggattgaatgatca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22597254 |
catcatcatcatcttcattgtcaggttgagctattggattttggtcaatactctcctaaaaaatgagaatgcaagagcacaataagggattgaatgctca |
22597353 |
T |
|
| Q |
117 |
atacaattaaaatgcaaaatgagttggtctgatttactctattgttgcaagtattataaaaattcatagtttaatcctttgacatagatgtgattaaaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22597354 |
atacaattaaaatgcaaaatgagttggtctgatttactctattgttgcaagtattgtaaaaattcatagtttaatcctttgacatagatgtgattaaaaa |
22597453 |
T |
|
| Q |
217 |
tatatttaacttcaaacaagtataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
22597454 |
tatatttaacttcaaacaagtataat |
22597479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 840 times since January 2019
Visitors: 6705