View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0884_low_4 (Length: 395)

Name: NF0884_low_4
Description: NF0884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0884_low_4
NF0884_low_4
[»] chr8 (1 HSPs)
chr8 (14-332)||(39759417-39759735)
[»] chr3 (1 HSPs)
chr3 (34-207)||(44569920-44570093)


Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 14 - 332
Target Start/End: Original strand, 39759417 - 39759735
Alignment:
14 aggggaacgaagttggtattttagcttttgaggttgcaaacactattgtcaagggcttcagtctcatggaatctctttcgacaaaaaatattaaacattt 113  Q
    ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39759417 aggggaatgaagttggtattttagcgtttgaggttgcaaacactattgtcaagggcttcagtctcatggaatctctttcgacaaaaaatattaaacattt 39759516  T
114 gaaagaagaggtgcttaaactagaggctgtgcaagatttagtatcaaaggatatggacgaacttttaaggattgttgctgcagacaagaggtaatggatt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39759517 gaaagaagaggtgcttaaactagaggctgtgcaagatttagtatcaaaggatatggacgaacttttaaggattgttgctgcagacaagaggtaatggatt 39759616  T
214 aaatcaaaacctcagagattccattaacaagctaactttcagttgttttagtttgaaatgccaacttgctctgatatttggtacgtttccagggatgaat 313  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39759617 aaatcaaaacctcagagattccattaacaagccaactttcagttgttttagtttgaaatgccaacttgctctgatatttggtacgtttccagggatgaat 39759716  T
314 tgaaagtattttctgatga 332  Q
    |||||||||||||||||||    
39759717 tgaaagtattttctgatga 39759735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 34 - 207
Target Start/End: Original strand, 44569920 - 44570093
Alignment:
34 ttagcttttgaggttgcaaacactattgtcaagggcttcagtctcatggaatctctttcgacaaaaaatattaaacatttgaaagaagaggtgcttaaac 133  Q
    ||||| || ||||||||||||||||||||||| || ||   |||  ||||||||||||| ||||||| |||||  ||| | |||||||||||||||        
44569920 ttagcattcgaggttgcaaacactattgtcaaaggttttcatctactggaatctctttccacaaaaagtattaggcatctaaaagaagaggtgcttcttt 44570019  T
134 tagaggctgtgcaagatttagtatcaaaggatatggacgaacttttaaggattgttgctgcagacaagaggtaa 207  Q
     |||| ||||||| |||||||| |||||||||| ||| |||||| | | ||||||||||||||| || ||||||    
44570020 cagagactgtgcatgatttagtgtcaaaggataaggatgaacttcttacgattgttgctgcagataaaaggtaa 44570093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 832 times since January 2019
Visitors: 6696