View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0884_low_4 (Length: 395)
Name: NF0884_low_4
Description: NF0884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0884_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 14 - 332
Target Start/End: Original strand, 39759417 - 39759735
Alignment:
Q |
14 |
aggggaacgaagttggtattttagcttttgaggttgcaaacactattgtcaagggcttcagtctcatggaatctctttcgacaaaaaatattaaacattt |
113 |
Q |
|
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39759417 |
aggggaatgaagttggtattttagcgtttgaggttgcaaacactattgtcaagggcttcagtctcatggaatctctttcgacaaaaaatattaaacattt |
39759516 |
T |
 |
Q |
114 |
gaaagaagaggtgcttaaactagaggctgtgcaagatttagtatcaaaggatatggacgaacttttaaggattgttgctgcagacaagaggtaatggatt |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39759517 |
gaaagaagaggtgcttaaactagaggctgtgcaagatttagtatcaaaggatatggacgaacttttaaggattgttgctgcagacaagaggtaatggatt |
39759616 |
T |
 |
Q |
214 |
aaatcaaaacctcagagattccattaacaagctaactttcagttgttttagtttgaaatgccaacttgctctgatatttggtacgtttccagggatgaat |
313 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39759617 |
aaatcaaaacctcagagattccattaacaagccaactttcagttgttttagtttgaaatgccaacttgctctgatatttggtacgtttccagggatgaat |
39759716 |
T |
 |
Q |
314 |
tgaaagtattttctgatga |
332 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
39759717 |
tgaaagtattttctgatga |
39759735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 34 - 207
Target Start/End: Original strand, 44569920 - 44570093
Alignment:
Q |
34 |
ttagcttttgaggttgcaaacactattgtcaagggcttcagtctcatggaatctctttcgacaaaaaatattaaacatttgaaagaagaggtgcttaaac |
133 |
Q |
|
|
||||| || ||||||||||||||||||||||| || || ||| ||||||||||||| ||||||| ||||| ||| | ||||||||||||||| |
|
|
T |
44569920 |
ttagcattcgaggttgcaaacactattgtcaaaggttttcatctactggaatctctttccacaaaaagtattaggcatctaaaagaagaggtgcttcttt |
44570019 |
T |
 |
Q |
134 |
tagaggctgtgcaagatttagtatcaaaggatatggacgaacttttaaggattgttgctgcagacaagaggtaa |
207 |
Q |
|
|
|||| ||||||| |||||||| |||||||||| ||| |||||| | | ||||||||||||||| || |||||| |
|
|
T |
44570020 |
cagagactgtgcatgatttagtgtcaaaggataaggatgaacttcttacgattgttgctgcagataaaaggtaa |
44570093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University